Synthetic Biology & the Importance of Assembly Standards

Posted by Guest Blogger on Jul 8, 2014 11:06:00 AM


The field of synthetic biology has seen tremendous growth in recent years. At Addgene, synthetic biology deposits have grown exponentially, from just 2 plasmids in 2005 to 439 plasmids deposited last year. To shed some light on this growing field, we asked our friends at iGEM to share their expertise and discuss the importance of standards in the field.

The following post was contributed by Kim de Mora, iGEM Fellow.

iGEM-competition-2014-synthetic-biology

What is Synthetic Biology?

“What I cannot create, I do not understand.” – Richard Feynman

This Feynman quote perfectly embodies the aims of synthetic biology in a single sentence. During the history of humanity, some of the most complex devices we have constructed are nuclear submarines, the space shuttle, the international space station and the Internet. But in all our existence, we have yet to design, engineer and build a cell from the ground up. A single bacterial cell is orders of magnitude more complex that the aforementioned feats of mechanical, aeronautical, electrical and computer engineering. These devices could be built because the underlying physical model of how the world works is understood by scientists and applied by engineers to practical ends.

While there are many definitions in the field, we at iGEM define synthetic biology as: the rational engineering of biological systems for novel and useful purposes. As a first step towards this goal, we have created the biological equivalent of Lego bricks, known to us as BioBricks. We can build simple transcriptional systems in a few days in the lab. We have promoters that are sensitive to arsenic, fluorescent proteins to be used as reporters and other useful genetic elements. These elements form the catalog of the Registry of Standard Biological parts and allow us to use biology as a substrate to apply engineering techniques.

There are several commercial examples of synbio worth checking out such as Amyris, Oxitec and Ginkgo Bioworks. And In the International Genetically Engineered Machine (iGEM) Competition, we have now have more than a thousand teams, working to use synbio in a variety of applications. Our teams have worked on creating gluten degradation drugs, tuberculosis drug screens, software to make designing DNA assemblies easier, virus construction kits and many more.

One of the things that cells do well is sense proteins, chemicals and other various compounds in the environment. Cells can also do basic computation. These two abilities will pave the way for an entirely new class of drugs based on living organisms that could, for example, find and kill cancer. We could also create organisms that remediate contaminated lands, grow fuel, make plastic from waste CO2 and many other applications.

Today, software developers can write, compile and test code in minutes, allowing for many iterations in a day. With current synthetic biology technology, this same process takes weeks or months. Synthetic biology has incredible potential as technologies continue to advance and we approach software in our ability to iterate experimentally.

iGEM and the Registry of Standard Biological Parts

At roughly fifteen years of age, Synthetic Biology is still a young field. Since I participated in the iGEM Competition in 2006, the Registry of Standard Biological Parts has grown from hundreds to more than 20,000 parts, iGEM has grown from 32 teams to 245 and synthetic biology has become a respected scientific and engineering discipline. Centers are being established, synbio is becoming integrated into the life science curriculum in many institutions and funding bodies are becoming increasingly aware of the potential of our discipline.

At iGEM, our core philosophy is “synthetic biology based on standard parts”. Standardized parts allow biological function to be discretized in terms of assembly, measurement, characterization and troubleshooting if your assemblies don’t function according to specification. While we have many types of parts for a number of different organisms in the Registry, they can all be assembled together thanks to a common standard.

iGEM-DNA-kit-2014-synthetic-biologyWhy are Standards So Important?

Standard parts make it easy to move a part from one plasmid backbone to another. By adopting one plasmid backbone, pSB1C3 as a “shipping” plasmid, it is easier for us to manufacture the annual DNA distribution (the ‘Kit of Parts’) and perform quality control without needing a huge staff of scientists. Similarly, the ease of moving a part from one plasmid backbone to another allows a user to move a part or system into the backbone that makes the most sense for a variety of different needs in addition to shipping, including assembly, manufacturing, operation, measurement, and more. Also, as DNA synthesis of longer segments has become less expensive, it is easier to design to the required standards.

The iGEM competition is a great example of standards in action. iGEM teams must adhere to BioBrick or another accepted standard in order to be accepted into our collection. The technical requirements for the BioBrick standard (also known as RFC #10) are:

  • Standard prefix:  GAATTCGCGGCCGCTTCTAGAG

  • Standard prefix if preceding a coding region: GAATTCGCGGCCGCTTCTAG (contains a start codon)

  • Standard suffix: TACTAGTAGCGGCCGCTGCAG

  • The part must not contain any of the forbidden restriction sites: EcoRI, XbaI, SpeI or PstI.

  • All plasmids must be shipped in the standard shipping backbone, pSB1C3 (parts.igem.org/Part:pSB1C3).

Synthetic biologists also utilize a variety of other physical assembly standards, such as BioBrick BB-2 (RFC#12), Silver Standard (RFC#23), Freiberg Standard (RFC#25), MoClo and Mammoblocks.

Beyond Assembly Standards

We are interested in assembly, but also in characterization and measurement. Being able to assemble parts together is useful, but knowing which ones you should choose is better. Ultimately, the value of a part is in the accuracy of the information you can use to specify its performance envelope. As we get better at designing organisms and synthesis becomes cheaper, faster and error rates improve, the information we will care about most is how parts work. The goal is to be able to use a part and know how it will work, without needing to speak to the designer.

We like to think of synthetic biology as being similar to the computer industry, sometime in the early to mid 1970’s. In technology terms, we still perform the vast majority of DNA manipulation operations by hand, instead of using robots. There are big incumbent companies, but no Google, Apple or Microsoft just yet. There are still many technologies we need to develop before having the “browser moment” of synthetic biology. But when that time finally does come, it will change everything.


 Thank you to our guest blogger!iGEM-logo

Kim de Mora iGEMKim de Mora, iGEM Fellow. Kim has been involved with iGEM since participating in the University of Edinburgh team in 2006. Hi team developed an arsenic biosensor. Kim currently has many roles in the iGEM foundation, the first of which is judging coordinator for iGEM. He organizes the head judging committee, judges at the regional competitions, World Championship Jamboree and more.

Resources


 Click here to find synthetic biology plasmids at Addgene 

Topics: Plasmid Technology, Synthetic Biology

Blog Logo Vertical.png

Subscribe to Our Blog

Recent Posts